Toggle navigation
GS Database
GS Wizard
GS Setup
GS Viewer
Help
SEVA
$_GET["nik"] ?> »
l03
Part metadata »
Position
G-9
Type
Linker
Code
l03
Vector
pSEVA181-Linker-34
Name
Linker_34
Fusion sites
34
Receptor vector
pSEVA181
Description
Linker with 34 FS (BpiI)
oriV
pUC
Size
2684
Sequence
TAGATAATTAGGCTAAACTATCCTTAAGG
Back