Toggle navigation
GS Database
GS Wizard
GS Setup
GS Viewer
Help
SEVA
$_GET["nik"] ?> »
l04
Part metadata »
Position
G-10
Type
Linker
Code
l04
Vector
pSEVA181-Linker-45
Name
Linker_45
Fusion sites
45
Receptor vector
pSEVA181
Description
Linker with 45 FS (BpiI)
oriV
pUC
Size
2684
Sequence
TAGATAATTAGGCTAAACTATCCTTAAGG
Back